Preclinical Safety (V.F., A.R.-G., F.H., R.T., C.H., A.E.M.V.) and
Oncology Research Group (D.C.), Novartis Pharmaceuticals
The metabolism of valspodar (PSC 833; PSC), which is developed as a
multidrug resistance-reversing agent, was investigated to assess the
potential for drug-drug interactions and the pharmacological activity
of major metabolites. The primary metabolites of PSC produced by human
liver microsomes were monohydroxylated, as revealed by LC/MS. The major
site of hydroxylation was at amino acid 9, resulting in M9, as
determined by cochromatography with synthetic M9. Dihydroxylated
and N-demethylated metabolites were also detected. PSC
metabolism in two human livers exhibited
KM values of 1.3-2.8 µM. The intrinsic
clearance was 9-36 ml/min/kg of body weight. PSC biotransformation was
cytochrome P450 (CYP or P450) 3A dependent, based on chemical
inhibition and on metabolism by Chinese hamster ovary cells expressing
CYP3A. Ketoconazole was a competitive inhibitor (Ki = 0.01-0.04 µM). The inhibition by
27 compounds, including four antineoplastic agents, corresponded to the
inhibitory potentials of these compounds toward CYP3A. For vinblastine,
paclitaxel, doxorubicin, and etoposide, the
IC50 values were 5, 12, 20, and 150 µM,
respectively. M9 was also an inhibitor, with a lower
apparent affinity for CYP3A (IC50 = 21 µM),
compared with that of PSC. M9 was also less active as a multidrug
resistance-reversing agent. M9 demonstrated low potency in
sensitizing resistant cells to paclitaxel and was a poor inhibitor of
rhodamine-123 efflux from paclitaxel-resistant cells. In addition,
compared with PSC, a higher concentration of M9 was needed to
compete with the photoaffinity labeling of P-glycoprotein. Conversely,
PSC inhibited only reactions catalyzed by CYP3A, including cyclosporine
A metabolism (IC50 = 6.5 µM) and
p-hydroxyphenyl-C3'-paclitaxel formation
(Ki = 1.2 µM). Thus, PSC behaves in a
manner very similar to that of other cyclosporines, and a comparable
drug-drug interaction profile is expected.
 |
Introduction |
The
development of
MDR1 by the overexpression of
the multidrug transporter Pgp is one of the major impediments to cancer
chemotherapy (Pastan and Gottesman, 1988
). Pgp is a member of a large
multigene family of ATP-binding cassette membrane transporters and
transports basic or neutral amphiphilic compounds, including some
anticancer drugs, i.e. the epipodophyllotoxins (etoposide
and teniposide), the anthracyclines (doxorubicin and daunorubicin), the
Vinca alkaloids (vincristine and vinblastine), and the
taxanes (paclitaxel), out of cells (Pastan and Gottesman, 1991
;
Higgins, 1992
). CSA is an effective MDR-reversing agent through
its inhibition of the Pgp transport of anticancer agents (Nooter
et al., 1990
; Sonneveld and Nooter, 1990
; Lehnert et
al., 1993
). Drawbacks to the use of CSA to reverse MDR in cancer
therapy include its immunosuppressive action and the potential for
renal side effects at the doses necessary to reverse MDR.
PSC is a new cyclosporine derivative that is superior to CSA as an MDR
inhibitor. PSC is a very potent inhibitor of Pgp, being approximately
10-fold more potent than CSA, and has the safety advantage that it
would not compromise patients because it lacks immunosuppressive
activity and nephrotoxicity (Boesch et al., 1991
; Twentyman
and Bleehen, 1991
; Te Boekhorst et al., 1992
). In
preclinical studies, the chemosensitizing effect of PSC was dose
dependent. PSC significantly prolonged survival times of MDR-P388
tumor-bearing mice when combined with doxorubicin (Boesch et
al., 1991
) and increased the sensitivity toward etoposide of human
carcinoma xenografts in nude mice (Keller et al., 1992
). Furthermore, clinical treatment with PSC resulted in increased intracellular accumulation of doxorubicin and vincristine in
Pgp-positive myeloma cells (Sonneveld et al., 1994
).
The combination of PSC with a chemotherapeutic agent resulted in marked
changes in the pharmacokinetics of the anticancer drugs. In clinical
trials, administration of PSC resulted in increased neutropenia and
significantly increased blood concentrations of doxorubicin,
paclitaxel, and etoposide (Fisher and Sikic, 1995
). Possible
explanations for the reduced blood clearance of the anticancer agents
in the presence of PSC include metabolic interactions at P450 and/or
reduced elimination via the bile because of PSC inhibition of the biliary ATP-dependent carriers (Böhme et al.,
1993
).
PSC maintains a cyclic undecapeptide structure, like CSA. The clearance
of CSA is dependent on biotransformation, and most drug-drug
interactions are metabolic (Campana et al., 1996
). PSC, like
CSA, was slowly eliminated as metabolites in the bile in rats and dogs.
PSC was also eliminated as metabolites after a single oral dose in
human subjects, with <0.1% of the dose appearing as unchanged PSC in
the urine and <14% (likely the result of unabsorbed PSC) appearing in
the feces (Hauck C, personal communication).
Because the available data for PSC indicate a potential for drug-drug
interactions similar to those of CSA and because PSC is intended to be
used in combination therapy with anticancer agents, metabolic
interactions were investigated using human liver tissue in
vitro. Potential clinical consequences are predicted based on the
enzyme(s) involved in metabolism and based on the reciprocal effects on
biotransformation of PSC and potentially coadministered drugs.
 |
Materials and Methods |
Chemicals.
Unlabeled PSC, [3H]PSC (518 GBq/mmol),
and [14C]PSC (1.96 GBq/mmol)
[cyclo-[(N-methyl)-3-oxo-5-[1(E)-propenyl]-L-leucyl-L-[[2,3,4-3H]
or
[1-14C]]valyl-sarcosyl-(N-methyl)-L-leucyl-L-valyl-(N-methyl)-L-leucyl-L-alanyl-D-alanyl-(N-methyl)-L-leucyl-(N-methyl)-L-leucyl-(N-methyl)-L-valine]], the PSC metabolite M9
[cyclo-[(N-methyl)-3-oxo-5-[1(E)-propenyl]-L-leucyl-L-valyl-sarcosyl-(N-methyl)-L-leucyl-L-valyl-(N-methyl)-L-leucyl-L-alanyl-D-alanyl-(N-methyl-4-hydroxy)-L-leucyl-(N-methyl)-L-leucyl-(N-methyl)-L-valine]], unlabeled and 14C-labeled tropisetron (1.98 GBq/mmol)
[1H-indole-3-[14C]carboxylic acid
(1"H,5"H)-8-methyl-8-azabicyclo[3.2.1]oct-3"-yl-ester], unlabeled and 14C-labeled ondansetron (1.60 GBq/mmol)
[1,2,3,4-tetrahydro-9-methyl-3-[(2-methyl-1H-imidazol-1-yl)-[14C]methyl]carbazol-4-one],
bromocriptine, CSA, etoposide, fluvastatin, diclofenac, and
(S)-mephenytoin were all from Novartis Pharma Inc. (Basel,
Switzerland). The purity of labeled PSC was >97% and that of labeled
tropisetron and ondansetron was >98%, as assessed by HPLC.
[3H]CSA (374 GBq/mmol),
[14C]doxorubicin (2.11 GBq/mmol),
[14C]chlorzoxazone (2.18 GBq/mmol),
[14C]tolbutamide (2.00 GBq/mmol), and
(S)-[14C]mephenytoin (2.22 GBq/mmol)
were obtained from Amersham International plc (Little Chalfont, UK).
[3H]Paclitaxel (618 GBq/mmol) was obtained from
Moravek Biochemicals (Brea, CA). Antipyrine, chlorpropamide,
chlorzoxazone, cholchicine, cimetidine, dextromethorphan, doxorubicin,
erythromycin, ethynylestradiol, glyburide, ketoconazole, nifedipine,
[14C]phenacetin (0.46 GBq/mmol), quinidine,
sparteine, paclitaxel, tolbutamide, vinblastine, and theophylline and
its metabolites (1-methyluric acid, 1,3-dimethyluric acid,
3-methylxanthine, and 1-methylxanthine) were purchased from Sigma
Chemical Co. (St. Louis, MO). [3H]Glyburide
(1887 GBq/mmol) was from DuPont de Nemours (Brussels, Belgium).
4-Hydroxymephenytoin, bufuralol, and hydroxybufuralol were obtained
from Ultrafine Chemicals (Manchester, UK).
[14C]Theophylline (1.93 GBq/mmol) was obtained
from Anawa Trading SA (Wangen, Switzerland), and unlabeled phenacetin
was from Fluka (Buchs, Switzerland). Lovastatin was a gift from Merck
Sharp and Dome (Rahway, NJ), and doxorubicinol was synthesized by
Mercian (Tokyo, Japan). All other reagents were obtained from
commercial sources and were of the highest grade available.
Human Liver Preparations.
Human liver tissue that could not be used for transplantation was
obtained as either pieces or microsomes from the International Institute for the Advancement of Medicine (Exton, PA) (HHM-0011 and
GGM-002) or from Vitron Inc. (Tucson, AZ) (HL-44). Microsomes from
livers GGM-002 and M8 were prepared by differential centrifugation as
previously described (Ball et al., 1992
). Microsomal protein concentrations were determined by the method of Bradford (1976)
, and
the P450 contents were determined from spectra obtained with carbon
monoxide according to the method of Omura and Sato (1964)
. Total P450
contents were 0.89, 0.44, 0.29, and 0.23 nmol of P450/mg of protein for
microsomal preparations HHM-0011, GGM-002, M8, and HL-44, respectively.
Human liver S9 fractions EOH 368-04 and EJS 882-08 were obtained from
Human Biologics Inc. (Phoenix, AZ) and exhibited P450 contents of 0.070 and 0.082 nmol/mg of protein, respectively.
Recombinant Human Proteins.
cDNA encoding either CYP3A4, CYP3A5, or CYP2D6 was cloned from human
liver mRNA that was reverse-transcribed into first-strand cDNA and
subjected to amplification by polymerase chain reaction. Specific
oligonucleotides were used that spanned full-length P450, with
CYP3A4-back and CYP3A4-forward primers (5'-agataagtaaggaaagtagtgatggc and 5'-tggatgaagcccatcttcatttcaga, respectively), CYP3A5-back and
CYP3A5-forward primers (5'-agataagtaaggaaagtagtgatggc and 5'-tggatgaagcccatcttcatttcaga, respectively), and CYP2D6-back and
CYP2D6-forward primers (gcaggtatggggctagaagcactggtg and
agcaggctggggactaggtaccccattcta, respectively). The cDNA clones were
subjected in their entirety to double-stranded sequencing. For CYP3A4
and CYP3A5, the sequences were in complete agreement with those
previously reported (Gonzalez et al., 1988a
; Aoyama
et al., 1989
), whereas a difference of 1 base pair was found
for CYP2D6, resulting in an arginine to cysteine exchange at position
140, compared with the published sequence (Gonzalez et al.,
1988b
). All three cDNAs were subcloned into an expression vector
containing a cytomegalovirus promoter/enhancer unit from commercial
vector pcDNA1 NEO (Invitrogen, Leek, The Netherlands). CHO-K1 cells
were used as recipients for transfection. Stable
geneticin-resistant cell clones with P450 activity were obtained
and propagated in Dulbecco's modified Eagle medium containing 25 mM
N-hydroxyethylpiperazine-N'-2-ethanesulfonic
acid, 1 mM sodium pyruvate, 4 mM glutamine, and 5.5 mM D-glucose. The
medium also contained 100 µg/ml gentamicin, 0.4 mg/ml geneticin
sulfate, and 0.4 mM L-proline and was supplemented with 10% fetal calf serum. Microsomes from cells expressing CYP3A4, CYP3A5, or CYP2D6 were
prepared from CHO-K1 recombinant cells as for human liver microsomes.
Isolated cells were lysed using a hand-held homogenizer, and cellular
debris was removed by centrifugation at 10,000g for 20 min.
The supernatant was centrifuged at 100,000g for 70 min, and
the microsomal fraction was resuspended in 10 mM potassium phosphate,
pH 7.4, 1 mM dithiothreitol, 20% glycerol, and stored at
80°C
before use. The specific P450 contents, as measured in spectra obtained
with carbon monoxide, were 70 and 134 pmol of P450/mg of microsomal
protein for P4503A4 and CYP2D6, respectively. The specific CYP3A5
content was less than spectrally detectable. The corresponding
catalytic activity for CYP2D6-mediated dextromethorphan O-demethylation was 80 nmol/hr/nmol of P450 (7.1 nmol/hr/mg
of protein) with 5 µM dextromethorphan; the activities for CYP3A4- and CYP3A5-mediated CSA metabolism were 28 nmol/hr/nmol of P450 (2.1 nmol/hr/mg of protein) and 0.3 nmol/hr/mg of protein with 1 µM CSA,
respectively.
Metabolism.
Human liver microsomal incubations were performed in 500 µl of 0.1 M
phosphate buffer, pH 7.4, at 37°C, except for PSC and CSA (200 µl)
and theophylline (100 µl). The substrate/inhibitor was added in
dimethylsulfoxide or ethanol, except for the chlorzoxazone incubations,
in which chlorzoxazone was dissolved in 60 mM KOH and PSC in
polyethylene glycol 400. The final vehicle concentration did not exceed
1%. Metabolism was initiated by the addition of 0.2 mM
-NADPH and
the NADPH-regenerating system, to yield final concentrations of 1 mM
NADP, 5 mM isocitrate, 5 mM MgCl2, and 1 unit of
isocitrate dehydrogenase. The reactions were stopped with an equal
volume of cold methanol [CSA, (S)-mephenytoin, doxorubicin, and doxorubicinol], 70% perchloric acid (bufuralol), or 10%
trichloroacetic acid, with cooling on dry ice. Control incubations were
performed in the absence of
-NADPH and the regenerating system or in
the absence of microsomal protein.
Additional typical incubation conditions, i.e. substrate
concentration, incubation time, and microsomal protein content,
respectively, were as follows: PSC, 0.1-25 µM, 15 min, 50 µg;
bufuralol, 5 µM, 60 min, 100 µg;
[14C]chlorzoxazone, 40 µM, 20 min, 50 µg;
[3H]CSA, 1 µM, 15 min, 50 µg;
dextromethorphan, 5 µM, 30 min, 50 µg;
[14C]doxorubicin and doxorubicinol, 40 µM, 60 min, 2 mg of S9 protein; [3H]glyburide, 5 µM,
40 min, 100 µg;
(S)-[14C]mephenytoin, 100 µM, 30 min, 500 µg; [14C]phenacetin, 20 µM, 30 min, 100 µg; [3H]paclitaxel, 1-100 µM, 20 min, 50 µg; [14C]theophylline, 50 µM, 60 min, 200 µg; [14C]tolbutamide, 150 µM, 40 min, 100 µg; [14C]tropisetron and
[14C]ondansetron, 50 µM, 40 min, 1 mg. For
identification of metabolites by LC/MS, higher protein concentrations
and longer incubation times may have been used. For all kinetic
studies, the incubations were performed under linear conditions with
respect to time and protein concentration. IC50
values for PSC (1 µM) metabolism were determined in the absence and
presence of potential inhibitors (ranging in concentration from 0.1 to
1000 µM, depending on solubility). For the microsomes derived from
the CYP3A4-, CYP3A5-, and CYP2D6-expressing cells, PSC and paclitaxel
were incubated primarily as described above, except that 250 mM
potassium phosphate buffer, pH 7.6, was used for CYP3A4 and CYP3A5.
HPLC Analysis.
Proteins were sedimented by centrifugation at 100,000g for
10 min at room temperature, and aliquots (200-350 µl) of the
supernatant were injected into the HPLC system. HPLC separations were
performed with a Kontron system (Kontron Instruments, Zürich,
Switzerland), a LB 507A radioactivity monitor (Berthold AG, Wildbad,
Germany), and a F1000 fluorescence detector (Merck, Darmstadt,
Germany). On-line radioactivity monitoring was used unless stated
otherwise. All compounds and their metabolites were characterized by
their retention times, by comparison of the chromatograms with those of
reference compounds, and/or by LC/MS analysis. The quantitation of
metabolites of radiolabeled compounds was performed by calculating the
relative peak areas of parent drug and metabolite peaks; for unlabeled
compounds, concentrations were calculated from standard curves.
[3H or 14C]PSC and its
metabolites were chromatographed at 75°C on LC 18 columns in series
(5-µm particle size, one column of 20 × 4.6 mm and two of
250 × 4.6 mm; Supelco Inc., Bellefonte, PA). The mobile phases
were 10 mM NH4HCO3/methanol
(9:1, pH 8.1) as solvent A and acetonitrile/methanol (9:1) as solvent
B. The proportion of solvent B was 0% for the first 1 min, was then
increased linearly to reach 30% at 10 min, 40% at 20 min, 70% at 120 min, and 90% at 140 min, and remained constant until 160 min. The
total flow rate was 0.8 ml/min. For LC/MS, mobile phase A was 50 mM ammonium acetate/methanol (9:1), and the proportion of solvent B was
0% for the first 10 min and was then increased linearly to reach 30%
at 20 min, 70% at 157 min, and 90% at 165 min. The total flow rate
was 1.2 ml/min.
Bufuralol and its metabolites were analyzed at room temperature on a LC
18-DB analytical column (5-µm particle size, 250 × 4.6 mm),
with a total flow rate of 1 ml/min. The mobile phases were 65% 0.2 M
NaClO4, pH 4/35% acetonitrile as solvent A and acetonitrile as solvent B. The proportion of solvent B was 0% for the
first 5 min, was increased linearly to 60% at 15 min, remained
constant until 20 min, and was then increased to 100% at 25 min. The
fluorescence detector was set to an excitation wavelength of 252 nm and
an emission wavelength of 302 nm.
[14C]Doxorubicin and its metabolites were
chromatographed at 40°C on a LC 18 analytical column (5-µm particle
size, 250 × 4.6 mm). The mobile phases were 0.28 M sodium formate
(adjusted to pH 3.55 with formic acid) as solvent A and methanol as
solvent B. The proportion of solvent B was 0% for the first 2 min, was increased linearly to reach 35% at 5 min, 60% at 65 min, and 100% at
67 min, and remained constant until 75 min. The total flow rate was 1 ml/min. Doxorubicinol metabolism was monitored at 254 and 490 nm.
[14C]Chlorzoxazone and its metabolite
6-hydroxychlorzoxazone were separated at room temperature on Spheri-5
phenyl columns (5-µm particle size; Brownlee, San Jose, CA),
i.e. a guard column (30 × 4.6 mm) and an analytical
column (100 × 4.6 mm). The mobile phase consisted of 90% 0.018 M
ammonium acetate buffer, adjusted to pH 4 with acetic acid, and 10%
acetonitrile. The flow rate was 1 ml/min.
[3H]Glyburide and its metabolites were
separated at 40°C on Brownlee RP-18 columns (5-µm particle size;
30 × 2.1 mm and 100 × 2.1 mm). The mobile phases were 10 mM
ammonium acetate, pH 4.3, as solvent A and acetonitrile as solvent B,
with a total flow rate of 0.4 ml/min. The proportion of solvent B was
0% up to 2 min, was increased linearly to reach 45% at 55 min, 80%
at 62 min, 100% at 72 min, and remained constant until 75 min.
(S)-[14C]Mephenytoin and its
metabolites were separated at 45°C on Brownlee RP-18 columns (5-µm
particle size, 30 × 4.6 mm and 100 × 4.6 mm). Solvent A was
water and solvent B was methanol, which was increased from 30% at 0 min to 100% at 10 min. The total flow rate was 1 ml/min.
[14C]Phenacetin and its metabolites were
analyzed at 35°C on LC 18-DB columns (5-µm particle size; Supelco),
i.e. a precolumn (20 × 4.6 mm) and an analytical
column (250 × 4.6 mm). The mobile phases were 5 mM
tetrabutylammonium hydrogen sulfate, 10 mM Tris base, 5 mM
ethylenedinitrilotetraacetic acid, pH 7.2, as solvent A and methanol as
solvent B. The proportion of solvent B was 0% for the first 5 min, was
increased linearly to reach 60% at 25 min, remained constant until 35 min, and then was increased to reach 100% at 45 min. The total flow
rate was 1 ml/min.
[3H]Paclitaxel and its metabolites were
chromatographed at room temperature on Spheri ODS columns (5-µm
particle size, 30 × 4.6 mm and 100 × 4.6 mm. The mobile
phases were water as solvent A and methanol as solvent B. The
proportion of solvent B was 0% for the first minute, was then
increased linearly to reach 50% at 5 min, 70% at 52 min, and 100% at
54 min, and remained constant until 65 min. The total flow rate was 1 ml/min.
[14C]Tolbutamide and its metabolite
4-hydroxytolbutamide were separated at 40°C on Spheri-5 RP-18 columns
(5-µm particle size; Brownlee), i.e. a guard column
(30 × 2.1 mm) and an analytical column (100 × 2.1 mm). The
mobile phases consisted of 10 mM ammonium acetate buffer (adjusted to
pH 4.3 with acetic acid) as solvent A and acetonitrile as solvent B. The proportion of solvent B was 5% for the first 1 min and was
increased linearly to reach 40% at 40 min and 100% at 45 min. The
flow rate was 0.4 ml/min.
[14C]Theophylline and its metabolites were
monitored after HPLC separation at room temperature on Supelcosil LC
18-DB columns (5-µm particle size, 20 × 4.6 mm and 250 × 4.6 mm). The mobile phases were 10 mM sodium acetate, pH 4.5, as
solvent A and acetonitrile as solvent B, with a total flow rate of 1 ml/min. The proportion of solvent B was 5% from 0 to 9 min, was
increased linearly to reach 15% at 15 min, and remained constant until
19%. In a linear increase, solvent B reached 27% at 30 min and
100% at 32 min.
[14C]Tropisetron,
[14C]ondansetron, dextromethorphan, and their
metabolites were analyzed as described (Fischer et al.,
1994
), except that dextromethorphan was analyzed with a Supelcosil
LC-DP column (5-µm particle size, 50 × 4.6 mm; Supelco), with a
flow rate of 1 ml/min. [3H]CSA and its
metabolites were analyzed as described by (Kronbach et al.,
1988
).
MS Analysis.
Positive-ion mass spectra were recorded with a TSQ-700 triple-stage
quadrupole mass spectrometer (Finnigan MAT, San Jose, CA) equipped with
an ESI interface. For PSC and its metabolites, 5 mM sodium acetate in
water/methanol (8:2) was added to the column eluent at 0.3 ml/min. The
total flow of 1.5 ml/min was then split ~1:1, with 0.75 ml/min going
to waste and 0.75 ml/min entering the ESI interface. For paclitaxel and
its metabolites, 0.2% trifluoroacetic acid in methanol was added to
the column eluent at 0.3 ml/min. The total flow of 1.8 ml/min was then
split ~2:1, with 1.2 ml/min going to waste and 0.6 ml/min entering
the ESI interface. For doxorubicin and its metabolites, 0.2%
trifluoroacetic acid in acetonitrile was added to the column eluent at
0.1 ml/min. The total flow of 1.0 ml/min was then split ~3:1, with
0.75 ml/min being used for on-line radioactivity monitoring and 0.25 ml/min entering the ESI interface. Glyburide was detected in the
negative-ion mode after addition of 0.1 ml/min acetonitrile, with 20-V
additional skimmer octapol voltage to induce fragmentation.
Methanol (0.05-0.1 ml/min) was used as the sheath liquid and nitrogen
served as the sheath and auxiliary gas. The ESI spray voltage was 3.5 kV for PSC, 3 kV for paclitaxel, and 4.5 kV for doxorubicin and
glyburide, with a capillary temperature of 250°C. Selected-ion
chromatograms for PSC and its metabolites were extracted from the raw
data files. The mass traces of the respective isotopes were added to
enhance the signal/noise ratio.
Pgp Interactions.
The paclitaxel-resistant MDA/T0.3 cells were selected from the
sensitive human adenocarcinoma cell line MDA-435, which was obtained
from the M. D. Anderson Cancer Center (Houston, TX)
(Archinal-Mattheis et al., 1995
). The drug concentration
that inhibited growth by 50% was determined as described (Monks
et al., 1991
). Photoaffinity labeling with a
[3H]cyclosporine derivative and inhibition
studies of rhodamine-123 efflux from MDA/T0.3 cells were performed as
described by Archinal-Mattheis et al. (1995)
.
Data Analysis.
For the calculation of metabolic rates, mean substrate concentrations
over the incubation period were used. IC50 values
were determined graphically by plotting the percentage of the control activity vs. the inhibitor concentration. The
Michaelis-Menten parameters KM and
Vmax and SEs were determined by nonlinear
curve-fitting using Fig.P software (BIOSOFT, Cambridge, UK), with the
following equation:
For PSC, an additional linear term was added to the
Michaelis-Menten equation, in case degradation was observed in control incubations, as described above.
Using a model for mixed-type inhibition, the
Ki values were calculated with the
following equation (Segel, 1993
):
where KM,i and
KM,u are the Michaelis constants and
Vmax,i and
Vmax,u are the maximal velocities in the presence and absence of inhibitor, respectively.
Intrinsic clearance (CLint) was calculated
by dividing the maximal rate of metabolism by the Michaelis constant,
according to the equation
Scaling of the intrinsic clearance to the body weight was
performed by taking into account the microsomal yield per gram of liver
and assuming an adult liver weight of 1.69 kg and a body weight of 70 kg. For calculations based on literature values, a yield of 15 mg of
microsomal protein/g of liver was assumed.
 |
Results |
Biotransformation Pathways.
PSC was metabolized in human liver microsomal preparations to several
metabolites (fig. 1). Structural
information on these metabolites was obtained by LC/MS analysis with
ESI (fig. 1, B-E). The chromatogram for the
natriated ion of monohydroxylated metabolites (m/z
1252) (fig. 1C) closely resembled the radioactivity profile (fig. 1A) and the total-ion current between m/z
1200 and 1400 for PSC metabolites (fig. 1B), indicating that
monohydroxylated products are predominantly formed under these
conditions in human liver microsomal incubations. Additional structural
information on the major monohydroxylated metabolite was suggested by
its having a retention time (120 min) identical to that of synthetic M9, which is hydroxylated at amino acid 9 (data not shown). Additional natriated ions were detected at m/z 1268, indicating dihydroxylated products (fig. 1D), and at
m/z 1222, suggesting N-demethylated products
(fig. 1E).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1.
PSC metabolite profile and identification in
human liver microsomes.
A, typical HPLC separation, with radioactivity
monitoring, of PSC and its metabolites formed in incubations of
[3H]PSC (10 µM) with human liver microsomes (500 µg/ml) for 2 hr. B-E, LC/MS analysis
of these metabolites using selected-ion monitoring, i.e.
total ion current between m/z 1200 and 1400 (B), monohydroxylated PSC at m/z 1252 (C), dihydroxylated PSC at m/z 1268 (D), and demethylated PSC at m/z 1222 (E).
|
|
Metabolite Interaction with Pgp.
Because M9 was the major metabolite in human liver
microsomes and in humans in vivo (Hauck C, personal
communication), its ability to inhibit Pgp function was examined using
the same human adenocarcinoma cell line (MDA/T0.3) as used previously
for PSC (Archinal-Mattheis et al., 1995
). These cells were
selected for resistance to growth inhibition by paclitaxel
(IC50 ~ 1 µM). Exposure of the cells to
paclitaxel in the presence of 1 µM M9 produced growth
inhibition at an 8-fold lower concentration of paclitaxel
(IC50 ~ 0.12 µM) (data not shown). In
comparison, PSC was much more potent and increased cellular sensitivity
~300-fold (IC50 = 2.8 nM). M9 was
also less potent than PSC in inhibiting rhodamine-123 efflux from
MDA/T0.3 cells (fig. 2). Complete
inhibition was obtained only with 5 µM M9, compared with 1 µM PSC. A similar difference in potency was observed when the binding of the photoaffinity label to Pgp was inhibited by PSC or M9 (fig. 3). Densitometric evaluation of the
labeled Pgp indicated 15-fold inhibition for PSC and 4-fold inhibition
for M9, at equal (84 nM) concentrations, with respect to the
[3H]cylosporine-derived label. With 10- and
100-fold excesses of PSC and M9, respectively, the binding
of the photoaffinity label was completely inhibited.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of PSC and M9 on
rhodamine-123 retention in MDA cells.
Sensitive MDA-435 (black histograms) and
paclitaxel-resistant MDA/T0.3 (white histograms) cells
were pretreated with dimethylsulfoxide (A), 0.1, 1.0, 2.5, or 5.0 µM PSC (B), or 0.1, 1.0, 2.5, or 5.0 µM
M9 (C) for 90 min. After incubation, the
cells were washed and incubated with rhodamine-123 for an additional 90 min. The cellular fluorescence was analyzed by flow cytometry.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 3.
Photoaffinity labeling of membrane-enriched
fractions from paclitaxel-resistant (MDA/T0.3) cells.
Cells were incubated with a [3H]cyclosporine derivative
photoaffinity label (84 nM) in the presence of PSC or M9 at
a 0-, 1-, 10-, 100-, or 1000-fold molar excess.
|
|
Intrinsic Clearance.
The rate of PSC metabolite formation was determined over the
concentration range of 0.1-25 µM in two human liver microsomal preparations, i.e. GGM-002 and M8. Metabolism followed
Michaelis-Menten kinetics, with similar KM
values for the two livers (1.3 and 2.8 µM for GGM-002 and M8,
respectively) (table 1). The
Vmax values were 6.7 and 3.3 nmol/hr/mg of
microsomal protein (15.2 and 11.4 nmol/hr/nmol of P450) for GGM-002 and
M8, respectively. Consequently, the intrinsic clearance was ~4-fold
greater for GGM-002, compared with M8, when scaled to body weight.
PSC was metabolized to the same metabolites as in human liver
microsomes by microsomal preparations from CHO cells genetically engineered to express human CYP3A4 or CYP3A5 but not by those from
cells expressing CYP2D6. The KM
values for CYP3A4- and CYP3A5-containing microsomes were 1.1 and 12.6 µM, respectively, which were similar to those in liver microsomes.
The maximal velocities of the reaction were 3.5 and 0.5 nmol/hr/mg of
microsomal protein for CYP3A4 and CYP3A5, respectively. Consistent with
these cells expressing only a single P450, the maximal velocity based
on total P450 content was 4-5-fold greater for CYP3A4-expressing cells
than for human liver. Because of low expression and a lack of P450
spectra, a similar comparison could not be made for cells expressing
CYP3A5. However, the results suggested that both CYP3A4 and CYP3A5 are the enzymes responsible for PSC biotransformation.
Inhibition of PSC Metabolism.
PSC metabolism (1 µM) was investigated in the presence of
characteristic P450 isoenzyme substrates/inhibitors and in the presence of compounds likely to be coadministered with PSC during therapy (table
2). The most potent inhibitors of PSC
metabolism were ketoconazole and CSA, with IC50
values of 0.1 and 0.5 µM, respectively. Ketoconazole inhibited PSC
competitively, with mean Ki values of
0.01-0.04 µM for both liver preparations. Ketoconazole at 0.1 µM
produced a 3-7-fold increase in the apparent
KM for PSC and at 0.5 µM produced a
23-67-fold increase in the apparent KM
for PSC with M8 and GGM-002 preparations, respectively, with no change in the maximal velocity. CSA was also a competitive inhibitor; its presence increased the apparent KM for
PSC 4-20-fold (Ki = 2.2 µM for
GGM-002). However, CSA also exhibited a noncompetitive component,
because the Vmax was decreased by factors
of 2 and 3 at 3.5 and 10 µM CSA, respectively. Other compounds that
inhibited PSC metabolism with an IC50 of
20
µM included the antineoplastic agents doxorubicin, paclitaxel, and
vinblastine, the antiemetic ondansetron, the antihypertensive agent
nifedipine, the antibiotic erythromycin, the antidiabetic glyburide,
the antiparkinsonian agent bromocriptine, the steroid ethinyl
estradiol, and the antihypercholesterolemic drug lovastatin (table 2).
The IC50 value for M9 of 21 µM was
also approximately 10-fold higher than the
KM for PSC.
Effects of PSC on the Metabolism of Other Drugs.
The potential for PSC to inhibit the metabolism of other drugs was
investigated with a series of compounds that are known to be
characteristic for certain P450s. Additionally, drugs that are likely
to be coadministered with PSC and that exhibited inhibition of PSC
metabolism were studied (table 3). PSC
had no effect (at concentrations up to 20 µM) on the metabolism of
phenacetin or theophylline (CYP1A2), tolbutamide (CYP2C9/10),
(S)-mephenytoin (CYP2C19), or chlorzoxazone (CYP2E1). Only a
small effect was observed for the CYP2D6 substrates dextromethorphan
and bufuralol, with maximal inhibition of 20 and 35%, respectively, at
20 µM PSC. However, the metabolism of the CYP3A substrate CSA was
inhibited by PSC with an IC50 of 6.5 µM,
consistent with CYP3A being involved in the metabolism of PSC.
View this table:
[in this window]
[in a new window]
|
TABLE 3
Effects of PSC on the metabolism of characteristic CYP substrates and
potentially coadministered compounds (IC50) in human liver
microsomes or in S9 fractions
|
|
Of the anticancer drugs, paclitaxel has been reported to be metabolized
by CYP2C8 and CYP3A4 (Cresteil et al., 1994
; Rahman et
al., 1994
). In vitro and in humans, CYP2C8 catalyzes
the formation of 6
-hydroxypaclitaxel, the major metabolite of
paclitaxel (Harris et al., 1994a
; Monsarrat et
al., 1993
). CYP3A4 has been suggested to be responsible for the
formation of the second most important metabolite,
p-hydroxyphenyl-C3'-paclitaxel (Harris et
al., 1994b
). p-Hydroxyphenyl-C3'-paclitaxel and
6
-hydroxypaclitaxel were confirmed to be M26 and
M35, respectively, in human liver microsomes (fig.
4). M35 and M26
exhibited fragmentation patterns in LC/MS, as described previously
(Bitsch et al., 1993
). Additional metabolites
monohydroxylated on the taxane ring were M29 and
M32, and that monohydroxylated on the side chain was
M30. The metabolite eluting at 24 min was hydroxylated on
both the taxane ring and the side chain. The involvement of CYP3A4
(Cresteil et al., 1994
; Harris et al., 1994b
) in
the formation of p-hydroxyphenyl-C3'-paclitaxel but not that
of 6
-hydroxypaclitaxel was confirmed with microsomes from CHO cells
expressing human CYP3A4. p-Hydroxyphenyl-C3'-paclitaxel was
formed at rates of ~0.02 and ~0.32 nmol/hr/mg of microsomal protein
(~0.29 and ~4.57 nmol/hr/nmol of P450) with 1 and 100 µM
paclitaxel, respectively. The HPLC peak corresponding to
p-hydroxyphenyl-C3'-paclitaxel did not increase in
incubations with microsomes from CHO cells expressing either CYP3A5 or
CYP2D6, compared with control incubations performed in the absence of
NADPH.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 4.
Paclitaxel metabolite formation.
A typical HPLC separation, with radioactivity monitoring, of paclitaxel
and its metabolites found in incubations of
[3H]paclitaxel (2.5 µM) with human liver microsomes is
shown. M26 and M35 were assigned as
p-hydroxyphenyl-C3'-paclitaxel and
6 -hydroxypaclitaxel, respectively.
|
|
With human liver microsomes (GGM-002, N = 4),
paclitaxel (1-100 µM) exhibited Michaelis-Menten kinetics, as
described (Cresteil et al., 1994
; Sonnichsen et
al., 1995
), with apparent KM values of 57.9 ± 43.8 µM for overall metabolism, 16.0 ± 4.5 µM
for p-hydroxyphenyl-C3'-paclitaxel formation, and 34.8 ± 28.5 µM for 6
-hydroxypaclitaxel formation. Vmax values were 277.3 ± 185.4, 15.8 ± 3.4, and 97.9 ± 58.3 nmol/hr/mg of microsomal
protein for total metabolism, p-hydroxyphenyl-C3'-paclitaxel formation, and 6
-hydroxypaclitaxel formation, respectively.
Intrinsic clearance values for
p-hydroxyphenyl-C3'-paclitaxel and 6
-hydroxypaclitaxel formation (1.0 ± 0.1 and 3.1 ± 1.0 ml/hr/mg of microsomal
protein, respectively) represented approximately 75% of total
intrinsic clearance (5.1 ± 0.9 ml/hr/mg of microsomal protein).
PSC selectively inhibited p-hydroxyphenyl-C3'-paclitaxel
formation. The inhibition was of a mixed type (fig.
5), with KM
values approximately doubling while Vmax
values were decreased by ~50% at 10 µM. The mean
Ki value was 1.15 µM, similar to the
KM for PSC metabolism.
In contrast, PSC (20 µM) had no effect on the metabolism of
doxorubicin (another antineoplastic agent) or its metabolite
doxorubicinol in two different human liver S9 preparations (table 3).
Doxorubicinol is the major metabolite of doxorubicin formed by the
ubiquitous cytoplasmic aldoketoreductase (Takanashi and Bachur, 1976
).
Both doxorubicin and doxorubicinol can also be converted by microsomal P450 reductase to the corresponding 7-deoxyaglycones (Bachur and Gee,
1976
). The assignment of the HPLC peaks was in agreement with the
molecular ions observed during LC/MS analysis (fig.
6).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 6.
Doxorubicin metabolite formation.
A typical HPLC separation, with radioactivity monitoring, of
doxorubicin and its metabolites found in incubations of
[14C]doxorubicin (40 µM) with a human liver S9
preparation is shown.
|
|
Similarly, PSC would not be expected to have a clinically relevant
effect on the metabolism of the antiemetics tropisetron and
ondansetron. These compounds were metabolized primarily to 5/6/7-hydroxytropisetron (3.9 nmol/hr/mg) and 7/8-hydroxyondansetron (1.6 nmol/hr/mg), as previously described (Fischer et al.,
1994
). The inhibition was small but concentration dependent,
i.e. 22% and 27% for tropisetron (50 µM) and ondansetron
(50 µM), respectively (table 3).
The effect of PSC on the metabolism of glyburide was investigated
because of the frequent use of glyburide as an antidiabetic agent and
because of its potential to inhibit the metabolism of CSA (Pichard
et al., 1990
, 1996
) and PSC. Previously, only
4-trans-hydroxyglyburide and
3-cis-hydroxyglyburide, which are hydroxylated on the
cyclohexyl moiety, had been identified and isolated from human urine
and feces (Rupp et al., 1969
). However, in five different
human liver microsomal preparations, glyburide was metabolized to
several additional metabolites (fig. 7).
LC/MS analysis did not result in detectable ions for M23
(6.1 nmol/hr/mg of protein), but M44-M49 (13.6 nmol/hr/mg of protein) and M53 (6 nmol/hr/mg of protein)
yielded ions of m/z 508, indicating monohydroxylation of
these metabolites. The observed fragment of m/z 170 for
M44-M53 and glyburide itself indicates that
hydroxylation did not occur on the 5-chloro-2-methoxybenzaldehyde moiety. Cleavage of the urea amide bond resulted in fragments of
m/z 367 for glyburide and peaks
M44-M49 or m/z 383 for peak
M53. This indicates hydroxylation on the cyclohexyl ring for
peaks M44-M49, which include the previously identified 4-trans-hydroxyglyburide and
3-cis-hydroxyglyburide, and hydroxylation on the phenylethyl
moiety for peak M53. Therefore, the previously identified
metabolites, which are considered to be the major metabolites in
humans, represented only a fraction of the peaks hydroxylated on the
cyclohexyl moiety, which are ~50% of the total metabolites in human
liver microsomes. In the presence of PSC (
20 µM), cyclohexyl
hydroxylation was not inhibited (table 3). In contrast, M23
was already inhibited ~40% with 5 µM PSC, and M53 was
inhibited 50% with ~3 µM PSC.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 7.
Glyburide metabolite formation.
A typical HPLC separation, with radioactivity monitoring, of glyburide
and its metabolites formed in incubations of
[3H]glyburide (5 µM) with human liver microsomes is
shown.
|
|
 |
Discussion |
The metabolism of the cyclosporine derivative PSC in human liver
is very similar, with respect to pathways and interactions with P450,
to that of other cyclosporines such as CSA, IMM 125, and CSG.
Therefore, for the prediction and interpretation of drug interactions
with PSC (when it is used in combination therapy), the extensive
clinical experience gained with CSA can be used as a guideline.
PSC is metabolized by human liver microsomes to monohydroxylated,
N-demethylated, and dihydroxylated products, as determined by LC/MS. These pathways have also been found in vivo
(metabolites detected in human plasma and urine) for PSC (Hauck C,
personal communication) and are analogous for the other cyclosporines
(Kronbach et al., 1988
; Maurer, 1985
; Vickers et
al., 1995
; Mangold et al., 1994
). The apparent
KM for PSC of the human liver microsomal
enzymes is similar to those reported for CSA (1.7-10 µM) (Fischer
et al., 1994
; Pichard et al., 1990
, 1996
; Maurer,
1985
), for IMM 125 (5.1 µM) (Vickers et al., 1995
), and
for CSG (5-9 µM) (Pichard et al., 1996
). Furthermore, the
intrinsic clearance of PSC determined with human liver microsomes
(9-36 ml/min/kg of body weight) is within the range estimated for the
other cyclosporines from literature values, as follows: CSA, 4-180
ml/min/kg of body weight (Fischer et al., 1994
; Maurer,
1985
); IMM 125, 4 ml/min/kg of body weight (Vickers et al.,
1995
); CSG, ~9 ml/min/kg of body weight (Pichard et al.,
1996
).
The metabolism of PSC, like that of the other cyclosporines, was CYP3A
dependent. PSC biotransformation was measurable only in cell lines
expressing CYP3A4 and CYP3A5 and not CYP2D6. In addition, compounds
that are known to inhibit CYP3A also inhibited PSC metabolism.
Furthermore, the inhibition was mainly competitive for the CYP3A
substrates CSA and ketoconazole. The potencies for inhibition of PSC
metabolism by the compounds tested (table 2) compare well with the
known potencies of these compounds to inhibit CYP3A. For example,
reported Ki values for CYP3A substrate
(CSA) inhibition are 0.7, 8, and 10 µM for ketoconazole,
bromocryptine, and nifedipine, respectively (Pichard et al.,
1990
), and 31 µM for ondansetron (Fischer et al., 1994
).
In contrast, compounds such as phenacetin, quinidine, dextromethorphan,
fluvastatin, and tolbutamide, which are known not to markedly inhibit
CYP3A, had little effect on PSC metabolism. The selective inhibition of
CYP3A-mediated reactions such as CSA metabolism and
p-hydroxyphenyl-C3'-paclitaxel formation by PSC also is
consistent with CYP3A being the major enzyme in PSC biotransformation.
The observed trend toward CYP2D6 inhibition, although consistent for
all investigated CYP2D6 substrates, i.e. dextromethorphan,
bufuralol, tropisetron, and ondansetron (Fischer et al.,
1994
; Dayer et al., 1989
; Yamazaki et al., 1994
; Dixon et al., 1995
), would be too small to be of any
clinical relevance. Overall, PSC appears to be a specific inhibitor of CYP3A.
PSC inhibited the metabolism of glyburide, a potentially coadministered
antidiabetic agent, to a limited extent. Only pathways that had not
been previously reported, including hydroxylation at the phenylethyl
moiety, were inhibited, indicating that these pathways must involve
CYP3A. In contrast, the lack of inhibition by PSC of the formation of
cyclohexyl-hydroxylated metabolites, such as
4-trans-hydroxyglyburide and
3-cis-hydroxyglyburide, indicates the involvement of enzymes
other than CYP3A in these pathways. The limited involvement of CYP3A in
glyburide metabolic clearance could explain why erythromycin, a CYP3A
inhibitor, did not affect glyburide clearance in a clinical trial
(Fleishaker and Phillips, 1991
). Because PSC is also a selective CYP3A
inhibitor, no clinically significant reduction in glyburide clearance
can be expected when PSC is coadministered. Glyburide should
also not influence PSC concentrations, because the
IC50 toward PSC metabolism is >1 order of
magnitude higher than its maximal plasma concentrations at a relatively
high 20-mg dose (Coppack et al., 1990
).
For the coadministration of PSC and paclitaxel, a result similar to
that observed with CSA, which also selectively inhibits p-hydroxyphenyl-C3'-paclitaxel formation in human liver
in vitro (Harris et al., 1994b
; Kumar et
al., 1994
), would be expected. Clinically, CSA increases
paclitaxel exposure; indeed, a similar 50% dose reduction of
paclitaxel was required when PSC was used instead of CSA (Fisher
et al., 1994a
,b
). Inhibition of paclitaxel elimination by
Pgp and/or inhibition of p-hydroxyphenyl-C3'-paclitaxel formation could contribute to the observed increase in plasma concentrations. However, it appears unlikely that either mechanism by
itself can explain the extent of the observed clinical effect. Paclitaxel is eliminated predominantly by metabolic clearance via the bile, and combined urinary and biliary excretion of
unchanged paclitaxel was only ~10% of the dose (Walle et
al., 1995
). Also, the major metabolite in 75% of human liver
microsomal preparations appears to be 6
-hydroxypaclitaxel, whereas
p-hydroxyphenyl-C3'-paclitaxel was the major metabolite in
~25% of human liver microsomal preparations (Sonnichsen et
al., 1995
). Paclitaxel did not influence CSA or PSC exposure in
humans, as expected based on the low plasma concentrations, compared
with the paclitaxel Ki value for CYP3A
inhibition (Fisher et al., 1994
; Smith H, personal
communication).
The clinically observed increases in doxorubicin exposure and reduced
clearance in the presence of PSC (Erlichman et al., 1993
;
Bartlett et al., 1994
) cannot be explained by a reduction in
doxorubicin metabolism by PSC. Doxorubicin is not metabolized by CYP3A,
and PSC had no effect on the formation of the major metabolite
doxorubicinol by the ubiquitous aldoketoreductase or on the removal of
the daunosamine sugar by the microsomal P450 reductase. Instead, a
major portion (50%) of doxorubicin is excreted unchanged in the bile
(Riggs et al., 1977
), and changes in tissue distribution and
reduced transport into the bile (Colombo et al., 1994
; Speeg
and Maldonado, 1994
) could explain the increased exposure and reduced
clearance observed in the clinical trials. Although doxorubicin was
also found to inhibit PSC metabolism in vitro, with an
IC50 value of 20 µM, the therapeutic range at
steady state is at least 100-fold lower (Meyer, 1994
), and the presence
of doxorubicin should not lead to relevant changes in the metabolic clearance of PSC.
Etoposide is approximately equally excreted in urine and bile (Lum
et al., 1992
). Approximately 20-35% of the etoposide dose is excreted unchanged in the urine and ~2% in bile. The remainder is
metabolized, and CYP3A is the main enzyme catalyzing etoposide O-demethylation (Relling et al., 1994
). Typical
therapeutic concentrations of ~17 µM (Lum et al., 1992
)
are approximately 5-fold below the KM for
CYP3A (Relling et al., 1992
) and 10-fold below the
IC50 for PSC metabolism. Etoposide should
therefore not be able to influence the metabolic clearance of PSC.
Conversely, PSC at typical concentrations of 4 µM could inhibit the
O-demethylation of etoposide. The observed increases in the
plasma concentrations of etoposide when it is combined with PSC may be
the result of a combination of inhibition of active secretion by Pgp
and inhibition of metabolism (Boote et al., 1996
). Because
the pharmacokinetics of other epipodophyllotoxins, such as teniposide,
are not significantly different from those of etoposide, similar
interactions with PSC would be expected.
Vinca alkaloids are also metabolized primarily by CYP3A4,
making their elimination susceptible to inhibition by PSC (Zhou et al., 1993
; Zhou-Pan et al., 1993
). However,
little is known regarding whether Vinca alkaloids are
excreted mainly unchanged or as metabolites. Therefore, it is difficult
to determine the exact mechanism for the increases in plasma
concentrations seen in clinical trials when PSC is coadministered with
Vinca alkaloids.
For the antiemetics tropisetron and ondansetron, metabolic drug
interactions with PSC are not expected. Both are only partially metabolized by CYP3A, and their therapeutic plasma concentrations are 2-3 orders of magnitude below the concentrations at which they
inhibit PSC metabolism in vitro (Fischer et al.,
1994
; Dixon et al., 1995
).
In summary, the evidence indicates that PSC is metabolized in a manner
analogous to that of other cyclosporines, by hydroxylation and
N-demethylation to less active metabolites. As with the
other cyclosporines, metabolism is mediated by CYP3A. The knowledge of
the enzymes involved in the biotransformation of PSC and the proof of
similarity to other cyclosporines will allow physicians to use the
clinical experience gained with CSA for better prediction and
interpretation of drug interactions with PSC.
We thank Drs. H. Andres, T. Moenius, and R. Voges for synthesis of the
radiolabeled compounds, Dr. R. Wenger for synthesis of the main PSC
metabolite, R. Nufer for LC/MS operation, and P. Kwon and N. Kohn for
technical assistance.
Received November 21, 1997; accepted March 31, 1998.
Abbreviations used are:
MDR, multidrug
resistance;
Pgp, P-glycoprotein;
CHO, Chinese hamster ovary;
CSA, cyclosporine A;
CSG, cyclosporine G;
CYP or P450, cytochrome P450;
ESI, electrospray ionization;
PSC, valspodar (PSC 833).